Top » Catalog » SNPs » A11668

$18.00

A11668
[A11668]

A11668
HG19 Position: ChrY:8069721..8069721
Ancestral: C
Derived: A
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11668_F CACATTTGCAAGATTTCCCTC
Reverse Primer: A11668_R CAACTACCCATAGCAAAACCTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10071
1 x A10539
1 x A10245
1 x A11440
$72.00
Haplogroup Info
Other products
Currencies