Top » Catalog » SNPs » A11670

$18.00

A11670
[A11670]

A11670
HG19 Position: ChrY:6918504..6918504
Ancestral: A
Derived: G
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11670_F GTGCATCTTTGAGCACATCG
Reverse Primer: A11670_R ACCCTGGCAACATAGACGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1169
1 x A10986
1 x A10667
1 x A10034
1 x A10912
1 x A11689
1 x A11624
1 x A11427
1 x A11388
$162.00
Haplogroup Info
Other products
Currencies