Top » Catalog » SNPs » A11673

$18.00

A11673
[A11673]

A11673
HG19 Position: ChrY:8769981..8769981
Ancestral: A
Derived: G
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11673_F GACTTCAACCAGACCCAGATG
Reverse Primer: A11673_R CTCAGGGAGACTAGAAGAGGACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies