Top » Catalog » SNPs » A11676

$18.00

A11676
[A11676]

A11676
hg38 Position: ChrY:8980593..8980593
Ancestral: C
Derived: T
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11676_F AATCAGCAGGATGTGTGCC
Reverse Primer: A11676_R CCTGACACCCATGTCTTTAGTCTC
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF41
DF41
M9
M9
S11556
S11556
L21
L21
L1335
L1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies