Top » Catalog » SNPs » A11691

$18.00

A11691
[A11691]

A11691
HG19 Position: ChrY:19092418..19092418
Ancestral: A
Derived: G
Reference: Janet Akaha (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY3293
Forward Primer: A11691_F GGCCTCAAGTGATCCATCTG
Reverse Primer: A11691_R AGTCTAGGGATGCCTGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11109
1 x A1077
1 x A10370
1 x A11667
1 x A10031
1 x A10983
1 x A10821
$126.00
Haplogroup Info
Other products
Currencies