Top » Catalog » SNPs » A11692

$18.00

A11692
[A11692]

A11692
HG19 Position: ChrY:21904540..21904540
Ancestral: A
Derived: T
Reference: Janet Akaha (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY3293
Forward Primer: A11692_F ATTTCTTGTCTGAACTCTGCTTCTG
Reverse Primer: A11692_R GATGCATTGTTTCGCTGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies