Top » Catalog » SNPs » A11693

$17.50

A11693
[A11693]

A11693
HG19 Position: ChrY:22742673..22742673
Ancestral: A
Derived: G
Reference: Janet Akaha (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY3293
Forward Primer: A11693_F CCTTGAATTGATAAACGATGTACAGAC
Reverse Primer: A11693_R CACATGCGGTTAGTGGTTACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies