Top » Catalog » SNPs » A11686

$17.50

A11686
[A11686]

A11686
HG19 Position: ChrY:21086208..21086208
Ancestral: A
Derived: G
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z253 > Z2534 > Z2185 > A7037 > S891
Forward Primer: A11686_F ACAAGGATAGAGCTAAATGAAAAATAAATAC
Reverse Primer: A11686_R GGAGGAGAAAGTTGAAACACTGTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A11689
A11689
A11688
A11688
A11687
A11687
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies