Top » Catalog » SNPs » A11701

$18.00

A11701
[A11701]

A11701
HG19 Position: ChrY:18733620..18733620
Ancestral: A
Derived: G
Reference: Richard Dodson (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A223 > A823
Forward Primer: A11701_F CCCTTTTCTAAAGATAATTTTGCC
Reverse Primer: A11701_R TGGAATACTATGCAGCCATGG
Reviews

Customers who bought this product also purchased
A11700
A11700
A11699
A11699
A11698
A11698
A11697
A11697
A11695
A11695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies