Top » Catalog » SNPs » A11703

$18.00

A11703
[A11703]

A11703
hg38 Position: ChrY:14434827..14434827
Ancestral: T
Derived: G
Reference: Kenth Johansson (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11703_F AAATGAGTCAATGATTATTAGAGTGTCTC
Reverse Primer: A11703_R GTGAGAGCAGAAATCTTCTCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies