Top » Catalog » SNPs » A11704

$17.50

A11704
[A11704]

A11704
HG19 Position: ChrY:17792061..17792061
Ancestral: T
Derived: A
Reference: Kenth Johansson (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11704_F AGGAAGAGATGTGGCAGCAG
Reverse Primer: A11704_R GGAAGGGATTTCACAGTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies