Top » Catalog » SNPs » A11704

$18.00

A11704
[A11704]

A11704
HG19 Position: ChrY:15680181..15680181
Ancestral: T
Derived: A
Reference: Kenth Johansson (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11704_F AGGAAGAGATGTGGCAGCAG
Reverse Primer: A11704_R GGAAGGGATTTCACAGTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11700
1 x A11492
1 x A11365
$54.00
Haplogroup Info
Other products
Currencies