Top » Catalog » SNPs » A11705

$18.00

A11705
[A11705]

A11705
HG19 Position: ChrY:15471369..15471369
Ancestral: C
Derived: T
Reference: Kenth Johansson (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11705_F AAAAGAGGACACTTGTGGAAACAG
Reverse Primer: A11705_R CATCTTAGTTTGGAGGCCATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1071
1 x A1063
1 x A11440
1 x A10221
1 x A10140
1 x A10270
1 x A10180
$126.00
Haplogroup Info
Other products
Currencies