Top » Catalog » SNPs » A11707

$18.00

A11707
[A11707]

A11707
HG19 Position: ChrY:19637806..19637806
Ancestral: T
Derived: C
Reference: Kenth Johansson (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11707_F TTCAAAGACTTCCTTTTGGTTTG
Reverse Primer: A11707_R TTGTGGAGCTTCAAGAGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies