Top » Catalog » SNPs » A11730

$18.00

A11730
[A11730]

A11730
HG19 Position: ChrY:19060321..19060321
Ancestral: C
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > S5488 > S6000 > FGC43492
Forward Primer: A11730_F CCTAACACTTTGGGAGTCCAAC
Reverse Primer: A11730_R ATTTCTCTTGGGCTAGAACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10047
1 x A1140
$36.00
Haplogroup Info
Other products
Currencies