Top » Catalog » SNPs » A11733

$18.00

A11733
[A11733]

A11733
HG19 Position: ChrY:14899915..14899915
Ancestral: A
Derived: G
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > S5488 > S6000 > FGC43492 > A11730
Forward Primer: A11733_F ATGGATAAAGAGTGATCACAGCC
Reverse Primer: A11733_R TGTAGAGTTCTCAGTATCATCGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies