Top » Catalog » SNPs » A11737

$18.00

A11737
[A11737]

A11737
HG19 Position: ChrY:17691580..17691580
Ancestral: T
Derived: C
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z253 > L1066 > FGC37012
Forward Primer: A11737_F CCCTTATATATTGCCCCCAAG
Reverse Primer: A11737_R ATCATGGAAGTTCACATCATGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies