Top » Catalog » SNPs » A11738

$18.00

A11738
[A11738]

A11738
hg38 Position: ChrY:12128744..12128744
Ancestral: G
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z253 > L1066 > FGC37012 > A11737
Forward Primer: A11738_F GGTGAAGGGGAAGGAAGATG
Reverse Primer: A11738_R GTCTTATTCTTTTACCCAAGCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies