Top » Catalog » SNPs » A11748

$17.50

A11748
[A11748]

A11748
HG19 Position: ChrY:19503884..19503884
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of PF6950
Forward Primer: A11748_F TGTGATTGTTGGTATATGACTGTCTG
Reverse Primer: A11748_R GCCTGGGTGACAGAGAGAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies