Top » Catalog » SNPs » A11749

$16.00

A11749
[A11749]

A11749
HG19 Position: ChrY:8274787..8274787
Ancestral: A
Derived: T
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of PF6950
Forward Primer: A11749_F CTCAGCACCCCAAAATGTTAC
Reverse Primer: A11749_R GGCACATTCAAACTGTGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies