Top » Catalog » SNPs » A11750

$17.50

A11750
[A11750]

A11750
HG19 Position: ChrY:2681703..2681703
Ancestral: A
Derived: T
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of Y4882
Forward Primer: A11750_F AGAGAAATGACAGGGGCAAG
Reverse Primer: A11750_R ACTTGCCCAAAATCAAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies