Top » Catalog » SNPs » A11752

$18.00

A11752
[A11752]

A11752
HG19 Position: ChrY:7680320..7680320
Ancestral: C
Derived: T
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20747
Forward Primer: A11752_F GTTTAGGTGCTGGTGCACAC
Reverse Primer: A11752_R TGCACAACAAGCTGACATGAC
Reviews

Customers who bought this product also purchased
Z296
Z296
L617
L617
Z2571
Z2571
DF79
DF79
S1327
S1327
L881
L881
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies