Top » Catalog » SNPs » A11752

$18.00

A11752
[A11752]

A11752
hg38 Position: ChrY:7812279..7812279
Ancestral: C
Derived: T
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20747
Forward Primer: A11752_F GTTTAGGTGCTGGTGCACAC
Reverse Primer: A11752_R TGCACAACAAGCTGACATGAC
Reviews

Customers who bought this product also purchased
BY3330
BY3330
Z225
Z225
BY30636
BY30636
L51
L51
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
L21
L21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies