Top » Catalog » SNPs » A11753

$18.00

A11753
[A11753]

A11753
HG19 Position: ChrY:17205579..17205579
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20747
Forward Primer: A11753_F GCTATGGTTACCTGATTGGAAATG
Reverse Primer: A11753_R TGCTGCAGCTGACTCTGAATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1003
1 x A1164
1 x A113
1 x A11403
1 x A10738
1 x A10314
1 x A10117
$126.00
Haplogroup Info
Other products
Currencies