Top » Catalog » SNPs » A11754

$18.00

A11754
[A11754]

A11754
HG19 Position: ChrY:19365697..19365697
Ancestral: G
Derived: C
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20747
Forward Primer: A11754_F CACTCAGCCTCCAAGTAGCTG
Reverse Primer: A11754_R CAATGCTACAGTACAAAAGGAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies