Top » Catalog » SNPs » A11603

$17.50

A11603
[A11603]

A11603
HG19 Position: ChrY:7687572..7687572
Ancestral: C
Derived: A
Reference: Colin Munro (2016)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > Y12059
Forward Primer: A11603_F CTGAGAGTAACATTATCAGGGTGG
Reverse Primer: A11603_R ACCGGTCTACATTGGGCAC
Reviews

Customers who bought this product also purchased
A11602
A11602
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies