Top » Catalog » SNPs » A11602

$18.00

A11602
[A11602]

A11602
HG19 Position: ChrY:7697554..7697554
Ancestral: A
Derived: G
Reference: Colin Munro (2016)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > Y12059
Forward Primer: A11602_F GTGGTACCACAGGGTGCG
Reverse Primer: A11602_R TGTCAGGAACATGTACACTTGTGAG
Reviews

Customers who bought this product also purchased
A11603
A11603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10324
1 x A11380
$36.00
Haplogroup Info
Other products
Currencies