Top » Catalog » SNPs » A11777

$18.00

A11777
[A11777]

A11777
hg38 Position: ChrY:18969500..18969500
Ancestral: T
Derived: A
Reference: Jef Treece (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF98 > Z4303
Forward Primer: A11777_F CCCAGGCCAACATTCTGTC
Reverse Primer: A11777_R ATGGATGAGGGCTAAACAGC
Reviews

Customers who bought this product also purchased
A11783
A11783
A11782
A11782
FGC10050
FGC10050
A11779
A11779
A11778
A11778
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies