Top » Catalog » SNPs » A11783

$18.00

A11783
[A11783]

A11783
HG19 Position: ChrY:19474497..19474497
Ancestral: A
Derived: G
Reference: Jef Treece (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF98 > Z4303
Forward Primer: A11783_F TGCCTGTAGCAACAGAATGG
Reverse Primer: A11783_R CCACAGCCATGATGTGAGAG
Reviews

Customers who bought this product also purchased
A11779
A11779
A11778
A11778
A11777
A11777
FGC10050
FGC10050
A11782
A11782
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies