Top » Catalog » SNPs » A11784

$18.00

A11784
[A11784]

A11784
HG19 Position: ChrY:16735930..16735930
Ancestral: C
Derived: A
Reference: Jef Treece (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF98 > Z4303
Forward Primer: A11784_F GCCATTGAGATTACAAGGAACAG
Reverse Primer: A11784_R CTAGCTCTATAAAATCACCAGGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies