Top » Catalog » SNPs » A11786

$18.00

A11786
[A11786]

A11786
HG19 Position: ChrY:7923600..7923600
Ancestral: C
Derived: G
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1b
Comments: Downstream Y15926
Forward Primer: A11786_F CAGGCTCAGATACAAGGCATG
Reverse Primer: A11786_R CATTGGGACATACCACTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies