Top » Catalog » SNPs » A11790

$18.00

A11790
[A11790]

A11790
HG19 Position: ChrY:18963056..18963056
Ancestral: T
Derived: A
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1b
Comments: Downstream Y15926
Forward Primer: A11790_F CATCTTGTTTTTCGTCCACAG
Reverse Primer: A11790_R GGGAAACTGAAAGACTTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies