Top » Catalog » SNPs » A11793

$17.50

A11793
[A11793]

A11793
HG19 Position: ChrY:22618111..22618111
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: J2
Comments: Downstream of Y13373
Forward Primer: A11793_F AAGGAAATCAAGTGGCGATG
Reverse Primer: A11793_R TCATCCCGTTTTCCTCAAAG
Reviews

Customers who bought this product also purchased
A11791
A11791
A11792
A11792
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies