Top » Catalog » SNPs » A11793

$18.00

A11793
[A11793]

A11793
HG19 Position: ChrY:22618111..22618111
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: J2
Comments: Downstream of Y13373
Forward Primer: A11793_F AAGGAAATCAAGTGGCGATG
Reverse Primer: A11793_R TCATCCCGTTTTCCTCAAAG
Reviews

Customers who bought this product also purchased
A11792
A11792
A11791
A11791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies