Top » Catalog » SNPs » A11796

$17.50

A11796
[A11796]

A11796
HG19 Position: ChrY:8670352..8670352
Ancestral: G
Derived: A
Reference: Charles Acree (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > L47 > Z159 > S2351 > S6915 > FGC33315 > A2156
Forward Primer: A11796_F GCCTTAGAATCAAGAAAGGATAGG
Reverse Primer: A11796_R GTGCACAGCATCCTAGGATATATG
Reviews

Customers who bought this product also purchased
A11795
A11795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies