Top » Catalog » SNPs » A11757

$18.00

A11757
[A11757]

A11757
HG19 Position: ChrY:6920046..6920046
Ancestral: A
Derived: G
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11757_F GCTGAGAAACCAATTGTTGGC
Reverse Primer: A11757_R CATGACTGTAATTTTCTGTTACACTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10071
1 x A11622
1 x A10580
1 x A10318
1 x A1
1 x A10129
$108.00
Haplogroup Info
Other products
Currencies