Top » Catalog » SNPs » A11760

$17.50

A11760
[A11760]

A11760
HG19 Position: ChrY:7431298..7431298
Ancestral: G
Derived: A
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11760_F ACCTCTGCTTTAAATCATCTTTCTG
Reverse Primer: A11760_R GAGACTACAGTTGCGCACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies