Top » Catalog » SNPs » A11761

$16.00

A11761
[A11761]

A11761
HG19 Position: ChrY:8347430..8347430
Ancestral: A
Derived: G
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11761_F CCAAAAAAGAAATGGTTGTTCATAG
Reverse Primer: A11761_R CAGGCACCCAGTCTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies