Top » Catalog » SNPs » A11764

$18.00

A11764
[A11764]

A11764
HG19 Position: ChrY:12110788..12110788
Ancestral: A
Derived: G
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11764_F GACACAGGTCCAGACAGCC
Reverse Primer: A11764_R GTTTGGAAGAGACATGCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies