Top » Catalog » SNPs » A11766

$17.50

A11766
[A11766]

A11766
HG19 Position: ChrY:17016980..17016980
Ancestral: C
Derived: T
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11766_F CTAAATGACATAGAAATACCACTCCAGAG
Reverse Primer: A11766_R GCAATTCGGTGACATTAATTATGTTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies