Top » Catalog » SNPs » A11767

$18.00

A11767
[A11767]

A11767
HG19 Position: ChrY:17117601..17117601
Ancestral: G
Derived: T
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11767_F CCTCATTCTGTCACTCAGGCTAG
Reverse Primer: A11767_R CATTACCCAAGTCTGTACAACGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies