Top » Catalog » SNPs » A11769

$18.00

A11769
[A11769]

A11769
HG19 Position: ChrY:18256916..18256916
Ancestral: A
Derived: T
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11769_F GGTGGTGGTGTTTGAAAGAG
Reverse Primer: A11769_R CCAGGAATGAGCAAATTACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies