Top » Catalog » SNPs » A11770

$18.00

A11770
[A11770]

A11770
HG19 Position: ChrY:16853639..16853639
Ancestral: G
Derived: A
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11770_F AGAGGCTAAGGCAGGAGAAAC
Reverse Primer: A11770_R AAAATGCAAATATCACTTGTATGAACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies