Top » Catalog » SNPs » A11773

$18.00

A11773
[A11773]

A11773
HG19 Position: ChrY:22819523..22819523
Ancestral: T
Derived: C
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11773_F TTGATGTTCTTGAGGGAGAAGTC
Reverse Primer: A11773_R TACCTACCGCTTGCTGTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies