Top » Catalog » SNPs » A11755

$17.50

A11755
[A11755]

A11755
HG19 Position: ChrY:2867433..2867433
Ancestral: A
Derived: G
Reference: Richard Dunn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11755_F AGCAGGCTTTTGATCACTTTG
Reverse Primer: A11755_R GGACATTGTGCAAGGTTGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies