Top » Catalog » SNPs » A11187

$18.00

A11187
[A11187]

A11187
HG19 Position: ChrY:14452790..14452790
Ancestral: C
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S744 > S764 > FGC28987
Forward Primer: A11187_F GATCATAGATCACTATAGCCTCGAAC
Reverse Primer: A11187_R GTAGAAACAAAAATGTAAAAATGTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10533
1 x A10353
1 x A11175
1 x A10234
1 x A10062
1 x A11396
1 x A11653
1 x A10963
$144.00
Haplogroup Info
Other products
Currencies