Top » Catalog » SNPs » A11187

$17.50

A11187
[A11187]

A11187
HG19 Position: ChrY:16564670..16564670
Ancestral: C
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S744 > S764 > FGC28987
Forward Primer: A11187_F GATCATAGATCACTATAGCCTCGAAC
Reverse Primer: A11187_R GTAGAAACAAAAATGTAAAAATGTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies