Top » Catalog » SNPs » A10937

$18.00

A10937
[A10937]

A10937
HG19 Position: ChrY:7089235..7089235
Ancestral: C
Derived: T
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10937_F TTTGTACAGACCGGTCTCACC
Reverse Primer: A10937_R CTCTTGCCCATCTAATCCTGTCT
Reviews

Customers who bought this product also purchased
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
A10943
A10943
A10942
A10942
A10940
A10940
A10938
A10938
A10947
A10947
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10103
1 x A11123
1 x A11003
1 x A10589
1 x A10145
1 x A10316
1 x A11615
1 x A10517
$144.00
Haplogroup Info
Other products
Currencies