Top » Catalog » SNPs » A10938

$18.00

A10938
[A10938]

A10938
hg38 Position: ChrY:8329272..8329272
Ancestral: T
Derived: C
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10938_F ACACATTCCCAGGAAAGCAG
Reverse Primer: A10938_R AGCTGTGGCCCTGAGTTG
Reviews

Customers who bought this product also purchased
A10942
A10942
A10940
A10940
A10937
A10937
A10947
A10947
A5616
A5616
A10944
A10944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies