Top » Catalog » SNPs » A10938

$18.00

A10938
[A10938]

A10938
HG19 Position: ChrY:8329272..8329272
Ancestral: T
Derived: C
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10938_F ACACATTCCCAGGAAAGCAG
Reverse Primer: A10938_R AGCTGTGGCCCTGAGTTG
Reviews

Customers who bought this product also purchased
A5616
A5616
A10944
A10944
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
A10943
A10943
A10942
A10942
A10940
A10940
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1077
1 x A10762
1 x A10987
1 x A10496
$72.00
Haplogroup Info
Other products
Currencies