Top » Catalog » SNPs » A10940

$18.00

A10940
[A10940]

A10940
HG19 Position: ChrY:13997420..13997420
Ancestral: G
Derived: T
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10940_F CTACACAATCATTCATTGGACTGC
Reverse Primer: A10940_R GTTTACAACATGCTGTTATGGAATC
Reviews

Customers who bought this product also purchased
A10938
A10938
A10937
A10937
A10947
A10947
A5616
A5616
A10944
A10944
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies