Top » Catalog » SNPs » A10940

$18.00

A10940
[A10940]

A10940
HG19 Position: ChrY:11876714..11876714
Ancestral: G
Derived: T
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10940_F CTACACAATCATTCATTGGACTGC
Reverse Primer: A10940_R GTTTACAACATGCTGTTATGGAATC
Reviews

Customers who bought this product also purchased
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
A10943
A10943
A10942
A10942
A10938
A10938
A10937
A10937
A10947
A10947
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11402
1 x A11532
1 x A11506
1 x A10129
1 x A11469
1 x A10306
$108.00
Haplogroup Info
Other products
Currencies